Well, given that some of the folks reading (that I really didn't suspect were actually reading) are theists, maybe I shouldn't outright insult them that much. Now, I don't want to accommodate them in any way, however I may need to be a little less abrasive. So she did give me a new years resolution to go for, which is to be less of a dick to theists.
I will do my best to be less of a dick, however I have some caveats and addendums to that...
- Disagreement is not an attack. All too often, a theists will play the victim card just because someone doesn't agree with them. That's bullshit and a total coward act. If you pull that, the gloves come off.
- If you actually believe the literal word of the bible, think the world is about 6,000 years old, and all that associated baggage, I have to attack that. Those bronze age fables are so wrong in so many ways that you are living in a fantasy. In a society where we DNA sequencing, spacecraft, electron microscopes, computers, aircraft, etc. having those sort of delusions are nearly criminal. I cannot abide or coddle that sort of insanity. Sorry.
- An idea, no matter whose it is, does not merit automatic respect. This applies to atheists as well as theists. What matters is the evidential support that the idea can bring forth. If you get upset because your precious idea doesn't have any evidence, then think instead of being stuck on it.
- Understand what the word evidence means! A personal experience, while real to you, in your brain, isn't proof. Generally, I find that what most people experience is easy to explain via numerous natural phenomenon that they are totally unaware of. Remember, an extraordinary claim will require extraordinary evidence.
- When I link to someone else's article, those are their words, not mine. Try to keep up!
Does this sound like a fair resolution to carry forward?





27 comments:
You're still a dick! :-)
Atheists - People who say they don’t believe that Creator God, nor any supernatural entity exists.
Fine - believe what you want. But they also say, at least every single atheist that blogs says that s/he doesn’t believe anything unless it is supported by evidence; scientific evidence. You know, the evidence that God does not exist has been observed, tested and verified.
This, even though matter / energy, space and time (the material universe) has not always existed.
This, even though matter / energy, space and time (the material universe) had a beginning out of literally nothing material. If you disagree, show me the observable, tested and verified evidence.
This, even though matter / energy, space and time (the material universe) could not create itself. If you disagree, show me the observable, tested and verified evidence.
This, even though matter / energy, space and time (the material universe) could not pre date itself.
This, even though a quantum event (one that's lasted 14 billion years) would have required the existence of m,e,s,t (the material universe). If you disagree, show me the observable, tested and verified evidence.
This, even though something immaterial and eternal (Super / supra natural) must have brought m,e,s,t (the material universe) into being. If you disagree, show me the observable, tested and verified evidence.
Atheists put their faith in one or more of the dozens of Atheist Origin of the Universe Mythologies even though not a single one of the universes they propose has any evidence for its existence. If you disagree, show me the observable, tested and verified evidence.
Atheists believe that Creator God doesn’t exist. If they didn’t believe this, they wouldn’t be atheists.
Atheists say that you can’t prove a negative, but they most certainly believe this negative that can’t be proven.
Atheists believe that some things can begin to exist without a cause, even though this has NEVER been observed, tested or verified. And don't even start on quantum mechanics; that'll just prove your ignorance.
Atheists believe that coded, formulated, specified complexity can come into being without an Intelligent Designer, even though this has NEVER been observed, tested or verified.
Atheists believe that inanimate and inorganic gases can evolve into life; that life can come from non life even though this has NEVER been observed, tested or verified.
Atheists - those who believe what they believe without scientific evidence.
Fine, so all those assertions you make about the universe (many of them rather incorrect) still don't prove a theistic god of any sort. All they prove is that our knowledge of the universe is incomplete. Saying "I don't know" is not the same as admitting that whatever idea pulled out of nothingness is then somehow the right idea. Your god(s) are in no way differentiated from the Flying Spaghetti Monster or any other gods.
Keep in mind, the idea of a Deistic god is one that doesn't have any contradictory evidence, so there is room for that type of entity. As soon as someone posits that their god has any effect on the universe as it exists now, then their idea can be tested, and every single instance of such testing has fallen short of the theists idea.
All you are doing is "Argumentum ad Ignorance" and supplying your god in place of scientific inquiry. The origins of the universe and abiogenesis are small gaps for your god to live in. What happens when we do figure these things out instead of actually admitting we don't know?
And tell me, which is the more humble? Science which actually admits ignorance because we haven't figured it out? Or religion, which proclaims an immutable truth just because we don't know, and substitutes an even more complex entity as the first cause (which then begs the question, if nothing can come from nothing, where did god come from? Turtles all the way down).
"Keep in mind, the idea of a Deistic god is one that doesn't have any contradictory evidence, so there is room for that type of entity"
Keep in mind that if a Deistic God exists, then atheism is not just wrong, it's dead in the water.
Keep in mind:
Either matter is eternal (but we know that it is not and cannot be eternal)
OR
The Cause of matter is immaterial and eternal.
To ask, WHEN did an eternal Creator begin to exist? OR, WHAT CAUSED an eternal Creator to begin to exist? are incoherent questions.
You say some of my statements are incorrect. Like what?
Do you know what a Deistic entity means? It's totally outside the universe, and has absolutely no effect what so ever on anything. That means that there still is no heaven or hell. Nor does it take any interest in the workings of anything in that universe that it may have been the first cause of. Once the universe gets started by this supposed Deistic thing, that's it. No other involvement at all happens, ever.
You said: "This, even though matter / energy, space and time (the material universe) has not always existed."
Actually, we don't know the answer. We have only been able to extrapolate back to the Plank Era. Before that, we really have no idea of what happened. There are many thoughts on this, but the current answer is "We don't know".
You said: "This, even though matter / energy, space and time (the material universe) had a beginning out of literally nothing material. "
Actually, it was (as best as we know) energy, not material. And again, the actual answer at this time is "I don't know"...
And so on.
All your assertions are a chain of statements based off a caricature of what science actually says about the big bang. Learn what scientists ACTUALLY postulate, not what you think they postulate, or have been told that they postulate by duplicitous apologetics websites. If you cannot be bothered to exercise this basic level of intellectual effort, then don't be surprised if people treat your attempts to erect 3,000 year old mythology, written by ignorant Bronze Age nomads, as being purportedly "superior" to the work of Nobel Laureates, with the scorn and derision such attempts deserve.
And saying "To ask, WHEN did an eternal Creator begin to exist? OR, WHAT CAUSED an eternal Creator to begin to exist? are incoherent questions." is also an intellectually degenerate position to take. Again, why is a creator any more probable than any other postulate? Andy why is that incoherent question if you specify a creator as opposed to some sort of energy field, or cosmic pickle? You are just copping out by proclaiming the answer to be unobtainable, so your fairy tale is protected from inquiry. Don't look behind the curtain...
"Atheists believe that coded, formulated, specified complexity can come into being without an Intelligent Designer, even though this has NEVER been observed, tested or verified. "
This is wrong. Atheists believe this, but so do religious believers, especially if they happen to be scientists or informed laymen on information theory.
It's also wrong to say that complexity has never been observed, tested, and verified. Cf. http://www.google.com/search?client=safari&rls=en&q=talk+origins+speciation&ie=UTF-8&oe=UTF-8#pq=talk+origins+complexity&hl=en&cp=46&gs_id=7i&xhr=t&q=experiments+which+disprove+irreducible+complexity&qe=ZXhwZXJpbWVudHMgd2hpY2ggZGlzcHJvdmUgaXJyZWR1Y2libGUgY29tcGxleA&qesig=hX7kwoJuxnz4QcGkSV0X_Q&pkc=AFgZ2tkYLaAxvQ2-ziDW1pRxX4ImHYAf5RgLEycf-dpioUb6pEOMB_OjtNSJNQSxm-3tFadqU2avHDn6VkcI_x_iDSjxsl6kbw&pf=p&sclient=psy-ab&client=safari&rls=en&source=hp&pbx=1&oq=experiments+which+disprove+irreducible+complex&aq=0w&aqi=q-w1&aql=&gs_sm=&gs_upl=&bav=on.2,or.r_gc.r_pw.r_cp.,cf.osb&fp=1266ea1efbd956be&biw=747&bih=672
...just for starters.
Sophisticated ignorance is still ignorance.
You said: "Keep in mind that if a Deistic God exists, then atheism is not just wrong, it's dead in the water."
Did you actually read and understand what I said? I didn't say that the deistic concept exists, I just said that it's the one that doesn't have evidence against it. Big difference. I contend that as a cause, a deistic entity is much more complex than the many other thoughts and ideas out there which are not supernatural. While there is room for the deistic entity, it's a very small room. And even then, it in no way seems to correlate with the deity portrayed in every religious text in the world.
Again, you are just making an unquestionable assertion. The way of the intellectually castrated.
Oh, ScottE, here is your link as a hyperlink (for some reason, blogger doesn't automatically do that in comments... And the whole "irreducible complexity" argument is such a weak argument that I didn't dignify it...
Do you know what a Deistic entity means?"
Yes. A supernatural (outside of nature) Creator = Atheism false and utterly without foundation - i.e. magic, fantasy, blind faith.
======
Do you believe that the material infinite (energy if you like) can and does exist? If you say, "I don't know," are you suggesting that the material infinite MIGHT exist, that matter didn't need a beginning, that the Steady State model is still an option? That idea may not be bronze age but believers in Steady State are definitely on the fringe of reality.
=====
"Bronze age goat herders"
It’s too early to fall back on name calling. The only things that I have stated are based on scientific evidence. A supernatural creator (by inference of what we see) is looking more and more likely by the year. We both know it.
=====
“Again, why is a creator any more probable than any other postulate?”
Because our universe exists and matter has not always existed. Nor can it bring itself into existence. That seems fairly logical to me.
=====
“Andy why is that incoherent question if you specify a creator as opposed to some sort of energy field, or cosmic pickle?”
Who’s Andy? :) I know - typo.
You can call it whatever you want, but it must possess the attributes of something that could bring a mathematically precise, life sustaining universe into being. It must be able to bring every single constant and quantity, including the exact number and type of neutrino into place at Planck time.
That's a nifty trick for a pickle but obviously not too difficult for whatever brought our universe into being.
You see, sir, energy or cosmic pickles or even spaghetti monsters are matter / energy and something non material and eternal (A Greatest Conceivable Being) would have had to bring them into being and endowed them with the ability to create our universe. I’m not saying that ours is the only universe (although it’s the only one we have evidence for). I’m saying that at some point in the past, an Immaterial (Spirit) Eternal Cause brought matter (our universe for the sake of argument) into being - therefore atheism is false and without support. Unless - matter is eternal / infinite and we know that it isn't.
You said, “It's also wrong to say that complexity . . . ”
This following is complexity: “Eg eg Im im Eg im”
The following is coded, formulated, specified complexity:
"I'm talking to people who hold to beliefs without evidence to support those beliefs."
The following is also coded, formulated, specified complexity:
0101011101101000001100101101110001000000110100101111100010000001110100011010000110010100100000010000011011011101110101011100100011100110110010100100000011011110110011000100000011010000111010101101101011000010110111000100000011001010111011001100101011011100111010001110011001000000110100101110100
In the American Standard Code for Information Interchange, i.e., Binary Code it says, “When in the course of human events . . .”
The following is also coded, formulated, spedified complexity:
ACTCTGGGACGCGCCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGAGGCCGAGTACAACGAGGGGTGAGGCGCGGGCCGGGGCTAGGGCTGAGTCCGCCGTGGGGCGCCGGCCGGGTGGGGGCTGAGTCCGCCCTGGGGTGCGCGCCGGGGGCGGGAGGCAGCGCTGCCATGAGGCCAGCGCCCCATGAGCAGCTTCAGGCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAAC
It’s about .00001% of the genetic instructions in a simple cell.
There is no need to get defensive. Methodological naturalism refers to intelligent agents and uses design detection on a regular basis on its own. Archaeologists, forensic scientists, cryptographers, and anthropologists infer past intelligence as cause all the time. Even astro biologists on the hunt for extraterrestrial intelligence have followed Sagan’s dictum that if we could find just one line of information, we have discovered proof of intelligence aside from our own.
Just one line of information.
That’s all it would take. However, place in front of atheists a volume of information equivalent to 1,000 sets of the encyclopaedia Britannica however and what do we get? “It’s just biological material, folks. There’s nothing to see here. Go on home.”
A coded system is always the result of a mental process. All experiences indicate that a thinking being voluntarily exercising his own free will, cognition, and creativity, is required. There is no known natural law through which matter can give rise to information, neither is any physical process or material phenomenon known that can do this.
Yet that is what atheists believe, have to believe, must believe at all cost in the absence of supporting evidence.
=====
You said: “a deistic entity is much more complex than the many other thoughts and ideas out there which are not supernatural.”
Just because Richard Dawkins tells you something doesn’t make it so. :-) A Deity may be able to do complicated things but that doesn’t make it complicated in and of itself.
=====
"While there is room for the deistic entity, it's a very small room."
Obviously I disagree because I prefer to follow the evidence.
=====
"And even then, it in no way seems to correlate with the deity portrayed in every religious text in the world."
I don’t care about a religious God. I’m showing you that atheism has less and less to support it by the year. Yet you cling to it like a life-saver.
=====
“The way of the intellectually castrated.”
Well, now you’re just trying to prove that you don’t need God in order to be a good person.
You Said: "Yes. A supernatural (outside of nature) Creator = Atheism false and utterly without foundation - i.e. magic, fantasy, blind faith."
But you missed the part where I also dismiss deism as the less likely mechanism of all the possible ones out there. And again, deism also means that said creator is outside the confines of this universe, and thus totally and wholly irrelevant to the functioning of everything in that universe. So while it may make atheism wrong, it still doesn't make any particular theistic idea right. Just totally and wholly irrelevant. And what's the consequence of being wrong if deism is right? I would contend absolutely none what so ever. Thereby deflating the need for any of your arguments. So, your point?
And your silly preoccupation with the information canard as somehow proving your gods... Now this is a particularly insidious brand of canard, because it relies upon the fact that the topic of information, and its rigorous analysis, is replete with misunderstanding. However, instead of seeking to clarify the misconceptions, theist canards about information perpetuate those misconceptions for duplicitous apologetic purposes. A classic one being the misuse of the extant rigorous treatments of information, and the misapplication of different information treatments to different situations, either through ignorance, or wilful mendacity. For example, Claude Shannon provided a rigorous treatment of information, but a treatment that was strictly applicable to information transmission, and NOT applicable to information storage. Therefore, application of Shannon information to information storage in the genome is a misuse of Shannon's work. The correct information analysis to apply to storage is Kolmogorov's analysis, which erects an entirely different measure of information content that is intended strictly to be applicable to storage. Mixing and matching the two is a familiar bait-and-switch operation that propagandists for theist doctrine are fond of.
However, the ultimate reason why theist canards about information are canards, is simply this. Information is NOT a magic entity. It doesn't require magic to produce it. Ultimately, "information" is nothing more than the observational data that is extant about the current state of a system. That is IT. No magic needed. All that happens, in real world physical systems, is that different system states lead to different outcomes when the interactions within the system take place. Turing alighted upon this notion when he wrote his landmark paper on computable numbers, and used the resulting theory to establish that Hilbert's conjecture upon decidability in formal axiomatic systems was false. Of course, it's far easier to visualise the process at work, when one has an entity such as a Turing machine to analyse this - a Turing machine has precise, well-defined states, and precise, well-defined interactions that take place when the machine occupies a given state. But this is precisely what we have with DNA - a system that can exist in a number of well-defined states, whose states determine the nature of the interactions that occur during translation, and which result in different outcomes for different states. Indeed, the DNA molecule plays a passive role in this: its function is simply to store the sequence of states that will result, ultimately, in the synthesis of a given protein, and is akin to the tape running through a Turing machine. The real hard work is actually performed by the ribosomes, which take that state data and use it to bolt together amino acids into chains to form proteins, which can be thought of as individual biological 'Turing machines' whose job is to perform, mechanically and mindlessly in accordance with the electrostatic and chemical interactions permitting this, the construction of a protein using the information arising from DNA as the template. Anyone who thinks magic is needed in all of this, once again, is in need of an education.
(Post spit due to length)
As for the canard that "mutations cannot produce new information", this is manifestly false. Not only does the above analysis explicitly permit this, the production of new information (in the form of new states occupied by DNA molecules) has been observed taking place in the real world and documented in the relevant scientific literature. If you can't be bothered reading any of this voluminous array of scientific papers, and understanding the contents thereof, before erecting this particularly moronic canard, then don't bother erecting the canard in the first place, because it will simply demonstrate that you are scientifically ignorant. Indeed, the extant literature not only covers scientific papers explicitly dealing with information content in the genome, such as Thomas D. Schneider's paper handily entitled Evolution And Biological Information to make your life that bit easier, but also papers on de novo gene origination, of which there are a good number, several of which I have presented in the past in previous threads. The mere existence of these scientific papers, and the data that they document, blows tiresome canards about "information" out of the water with a nuclear depth charge. Post information canards at your peril after reading this.
Whilst dwelling on information, another theist canard also needs to be dealt with here, namely the false conflation of information with ascribed meaning. Which can be demonstrated to be entirely false by reference to the following sequence of hexadecimal bytes in a computer's memory:
81 16 00 2A FF 00
To a computer with an 8086 processor, those bytes correspond to the following single machine language instruction:
ADC [2A00H], 00FFH
To a computer with a 6502 processor, those bytes correspond to the following machine language instruction sequence:
CLC ASL ($00,X) LDX #$FF BRK
To a computer with a 6809 processor, those bytes correspond to the following machine language instruction sequence:
CMPA #$16 NEG $2AFF NEG ??
the ?? denoting the fact that for this processor, the byte sequence is incomplete, and two more bytes are needed to supply the address operand for the NEG instruction.
Now, we have three different ascribed meanings to one stream of bytes. Yet, none of these ascribed meanings influences either the Shannon information content, when that stream is transmitted from one computer to another, or the Kolmogorov information content when those bytes are stored in memory. Ascribed meaning is irrelevant to both rigorous information measures. As is to be expected, when one regards information content simply as observational data about the state of the system (in this case, the values of the stored bytes in memory). Indeed, it is entirely possible to regard ascribed meaning as nothing other than the particular interactions driven by the underlying data, once that data is being processed, which of course will differ from processor to processor. Which means that under such an analysis, even ascribed meaning, which theists fallaciously conflate with information content, also requires no magical input. All that is required is the existence of a set of interactions that will produce different outcomes from the different observed states of the system (with the term 'observation' being used here sensu lato to mean any interaction that is capable of differentiating between the states of the system of interest).
As is typical of theists, you have it all backwards...
You said: "A Deity may be able to do complicated things but that doesn’t make it complicated in and of itself. "
So would it be "just nature" then? Which doesn't really make for much of a deity, rather a natural process. Making pretty much any theistic argument moot.
So would it be "just nature" then?"
No, honey. Nature didn't exist. Remember? I'd asked, "Are you a Steady State believer? Matter has always existed?"
Remember extraordinary claims require extraordinary evidence. Where's the beef sir? Simply wanting to believe something doesn't make it so.
I'm starting to think you might be one of those naturalists who talk about "right" and "wrong" but believe in determinism. Ya?
Atheism - absurd, illogical, incoherent from stem to stern.
"But you missed the part where I also dismiss deism as the less likely mechanism of all the possible ones out there."
Less likely? Than what?
. Nothing created everything material?
. The universe didn’t need a cause?
What is more likely than an Immaterial Cause brought the material universe into being?
=====
Deism . . . So while it may make atheism wrong . . . And what's the consequence of being wrong if deism is right?
It’s ok to be wrong if the consequences are small? Are you serious?
It’s only important to you to be an atheist if it involves a Creator Who will deal out catastrophic consequences for defying Him?
And I thought my ex husband got weird. What do you think would happen if you simply went with the evidence? Are you so fragile that allowing for something greater than yourself would destroy your macho self-image?
What is the problem with:
I don't know.?
This is, and should always be, a perfectly acceptable answer to any and all questions. Just because someone doesn't know something, doesn't mean some batshit crazy idea is therefore the correct answer. We do know what happened up until Plank Time (as best as we can).
Really, are you so dense as to not understand what "I don't know" means? And are you so special as to actually know? Because, that is worthy of a Nobel Prize or three if you could actually demonstrate that knowledge instead of just pulling shit out of your ass.
And by the way, given the postulation of the "multiverse" (which sadly only has mathematical support since it's outside our ability to test as of now), there may actually have been "nature" prior to the big bang (no, I don't adhere to steady state, which has been shown incorrect based on evidence).
So, what is the logical consistency of theism if atheism has no logical consistency? I see no EVIDENCE that your claim is any more true than any other claim, deistic or not. (If you must know, the full description of my stance is agnostic atheist on the issue of deism (See this chart for an explanation) - I don't believe in any god(s) and live my life as if they didn't exist, and I don't think that the question can be reasonably answered. Although, I do claim gnostic (or strong) atheism on gods that are defined to actually DO things in this universe, since those actions have failed all evidentiary inquiries.) You are making the claims of a "creator" so it is incumbent on you to actually provide EVIDENCE, not just word games that substitute for "I don't know". Your first post is NOT evidence of anything except ignorance on the part of all mankind (i.e. argumentum ad ignorantiam).
Theism - A position based on ignorance unsupported by anything aside from assertions. In other words, just lies made up on the spot.
“What is the problem with: I don't know.”
Because you live as though you DO know. I hope I’m wrong but I don’t think for one second that you approach the evidence with an open mind. You see something for which "material" cannot possibly be the answer but you assume "material" is the answer. That, in my mind is an illogical way to live and yet you boast about treating people who point this out to you in a rude manner.
=====
"Just because someone doesn't know something, doesn't mean some batshit crazy idea is therefore the correct answer."
I agree, but if nature has not always existed, why is suggesting a Cause from outside nature a batshit crazy idea? If you answer nothing else, please tell me that?
=====
"You are making the claims of a "creator" so it is incumbent on you to actually provide EVIDENCE."
I can. But it's incredibly long and since you've already made up your mind I doubt that it would do any good. So let me just say, that except for epistemic, experiential, logical, coherent and reasonable evidence for the existence of God, I could be an atheist.
Can I or anyone else PROVE that Creator God exists. Of course not, just as you can’t prove that ONLY the material exists. But you live as though only the material exists even though you don't have the evidence to prove it.
I believe that there is enough evidence to make it more than likely that something from outside of nature brought nature into being and if that something exists, then I think it would be prudent to find out as much about that “Being” as possible.
You Said: "I can. But it's incredibly long and since you've already made up your mind I doubt that it would do any good. So let me just say, that except for epistemic, experiential, logical, coherent and reasonable evidence for the existence of God, I could be an atheist."
If you can prove the existence of some sort of creator, even though not here, I look forward to hearing about you getting those Noble Prizes. Please let me know your name so I can applaud you when you are in Stockholm.
Seriously, I know what evidence would actually convince me, and I am open to it, however so far it has been totally lacking. Provide it and I will change my mind. Until such time, all I am seeing is unfounded assertions.
I told you that I couldn't prove a Creator God any more than you could prove a material only universe. But I do believe there is enough evidence, at least for me, to tip the balance in favour of a Creator.
=====
"Seriously, I know what evidence would actually convince me, and I am open to it, however so far it has been totally lacking."
I was going to ask you exactly that. What evidence would be, if not compelling, at least make you sit up and listen?
First of all, you seem to be under the mistaken opinion that if science says something, it's the end of the story... No. Science is a methodology that only presents the best current model for understanding the observable universe based on the available information. Scientific models are always open to falsification or modification. There are no "sacred truths" in science as there are in religion. Anyone who would say, "science said it so it must be true" is only demonstrating an ignorance of the way science is utilized as a tool of investigation.
As to what sort of evidence (aside from jsut existence?) would make me consider a BEING as the responsible mechanism? Here are a couple ideas:
- An actual message in the CMB that points to intelligence rathe than natural occurences.
- A "Kilroy was here" type of sign in our DNA (something which so far has not turned up in any of the DNA we have sequenced by the way).
- A NEW discovery that actually constitutes EVIDENCE that we haven't thought of yet.
Again, when you say "But I do believe there is enough evidence, at least for me, to tip the balance in favour of a Creator" I still have not seen you provide any of that "evidence" aside from your argumentum ad ignorantiam. You know, it's perfectly okay to leave the question unanswered.
Thank you, thank you, a thousand times thank you, for giving me what it would take for you to say, "Hmmm." So often I get something like, "If Jesus just appeared in front of me." No, that wouldn't do it, because a naturalist would just come up with a natural explanation for why . . . Well, you get the idea.
I was thinking. One of the reasons that Christians and atheists have such a difficult time communicating, is that we often don’t say what we mean. Or rather, we don’t say EVERYTHING that we mean. Here’s an example. When talking about origins of the universe, one must confront the scientific fact that at one point nothing “natural” or “material” existed. Literally nothing. The material universe appeared ex nihilo. That means that there was nothing natural or material to bring the material universe into existence.
It’s at this point that atheists, at least the honest ones allow that a pretty good case could be made for a Diestic creator. Something supernatural brought the matter, energy, space, time and the laws of physics into existence, “But that has nothing to do with a Theistic God.”
That’s right, it has nothing to do with a Theistic God but it is sufficient to do away with atheism.
That’s one response that atheists give. They allow for a Deistic God because they haven’t clued into the fact that they’ve just given up atheism.
The second response is, “I don’t know. What’s wrong with saying, “I don’t know.””
Well, there’s nothing wrong with saying that, except that isn’t all that the atheist means. What the atheist really means is, ‘I don’t know what the natural or material answer could be (since nothing natural or material existed) but I do know that whatever caused the universe to appear has nothing to do with anything outside of nature. I do know that at some point in the future, we will have a material answer to the problem of everything material coming from nothing material in some unknown fashion (perhaps it didn’t need a cause) and then all will be safe for atheists once again.’
And that, to atheists, if not called crazy thinking.
As to your answer re: "Kilroy was here,"
No living molecule is self-reproducing. Not only is DNA incapable of making copies of itself, but it is incapable of “making” anything else. The proteins of the cell are made from other proteins, and without that protein-forming machinery nothing can be made.”
Did you get that?
Our cells don’t just contain a place to store vast amounts of information. They contain a code, a specified code (information) for translating that code AND they contain a means, a processing system which allows the construction of proteins.
Two questions arise:
. Where did the code (information) come from? And
. Aren’t we saying that proteins have to exist in order for proteins to exist?
If, as atheists propose, that all of these systems evolved, they’re also saying that PROTEINS WITH A DECODING ABILITY EVOLVED BEFORE THE PROTEIN WITH THE DECODING SYSTEM ITSELF EVOLVED.
Both the coding and decoding systems of protein cells are made by this very process of coding and decoding. The code that is used to build enzymes is decoded during the decoding process that the decoding process itself makes happen. How can that be?
The synthesis of proteins requires a tightly integrated sequence of reactions, most of which are themselves performed by the synthesis of proteins.
“The (DNA) code is meaningless unless translated. The modern cell’s translating machinery consists of at least fifty macromolecular components which are THEMSELVES coded in DNA: the code cannot be translated other than by products of translation. Jacques Monod, “Chance and Necessity.”
If proteins must have arisen first then how did they do so, since all extant cells construct proteins from assembly instructions in DNA. How did either arise without the other?
That atheist’s answer. A monkey had a billion years and presto! Out came life itself.
I disagree. I think this is powerful evidence that there is more to life than what meets the eye.
You Said: "When talking about origins of the universe, one must confront the scientific fact that at one point nothing “natural” or “material” existed. Literally nothing. "
Actually, that is not a correct statement. We don't know one way or another. For instance, the entire multiverse idea invalidates that statement. As well as an oscilating universe (which is an idea that I don't think has enough evidence to even marginally support, but I could be wrong). Since your first statement is not correct, just specualtion or assertion on your part, all following arguments are unsupported as well. That may be a fundamental problem in our discussion as far as an understanding. And again, it is no more valid to postulate a deistic entity (or space pickle) as it is a natural occurence.
I think I rebutted your DNA infomration argument earlier in two parts which you didn't seem to read or address. Your assertions are built on a fualty understanding of information and replication. Don't worry, it's a common misconception and perfectly understandable.
You Said: "That atheist’s answer. A monkey had a billion years and presto! Out came life itself."
I know that this was an attempt at a joke, but it's a very, very bad one. Again, all I am seeing are assertions based on an incomplete undesrtanding, and nothing more. I have an old thread that lists 88 scientific papers on self replicating molecules. Maybe those will help with some of your misunderstandings?
Have you always been an atheist or was religion part of your life at one time?
I flirted with religion when I was a teenager (christianity, although not sure what branch out of the 38,000 different ones, although it seemed rather evangelical from the camp I attended). I at one time figured that deism was a reasonable approach until I learned more of cosmology, physics, etc. However, I abandoned that in my early 20s.
Oh, I should mention, while I don't have much personal experience with religion, my wife grew up in a pentacostal/fundamentalist household. She was starting to question things when I first met her, and by the time we got married, she had ditched all supernaturalism.
Thank you again for responding. Mine experience was just the opposite. By my thirties I'd become aware that there is just "something" mixed with what I call evidence (inductive to be sure) that I just had to follow it to see where it led.
I know, for you it would seem irrational, but for me, not so.
Listen, thank you for your time. Hope I didn't throw you off your New Years Resolution to become a nicer person. Although on determinism you are what you are - yes? Hope you have a good year.
Sorry about posting anonymous, my ex would do me harm if he could find me.
Wow, sounds like a crappy ex! My condolences!
Have a good one too!
Post a Comment